Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687383
Length 718 bp
Fasta Format > whrd10a01
cccctcccccgccaggcccctcccgctccctctcctcgctcgggtgcttc ctccctccctctgtccactccactcgccactggctccgttcggtccgtga atcttgaccgacccgcctgagccggcagccaccggtggcctgctgccgcc tctcgctccagtggtggtgtggctacgagctgcggacggagggggtccgg gatggagcggtacgaggtgatcaaggacataggctcgggcaacttcgggg tggccaagctggtccgggacgtcaggaccaaggagctcttcgccgtcaag ttcatcgagagggggcacaagattgatgagaatgttcaaagggagattat gaaccacagatctctgaggcatccgaatattgttagattcaaagaggttg tgctaactcccacacatttggccatagttatggaatacgctgctggcggt gagctattcgaaaggatctgcagttctggaagatttagcgagaatgaggc taggttcttcttccaacaattgctttcaggagttagctattgccattcca tgcaaatatgtcatagagatctgaaactagaaaacacactcctggatgga agcgaagcaccccggctcaagatatgtgatttcggttactccaagtcctc tgtgttgcattctcaaccaaaatcaaccgtcggtactcctgcctacattg cccccgangtcctttcta
Download
page-top