Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ578322
Length 643 bp
Fasta Format > rwhpc18p18
aagcagagtcgtacagcagagttttggacaaaagtgaagttcacaaaaga ccttcatacgagataggccattgtttcaactcgtagtttaggccttgccg gactcctcgcaacccggtggcctaaaggcgatgaagctgacgcactgcac ctggcgcaggttgtcgaagccgatgacacggacataggcgtcagggtact ccttcttgacctcctccacctcgttcagcacctgtgtggcgtcagtgcac ccgaacataggcagcttccacattgtccagtatcggccgtcgtagtaccc gggggagctgttgtgctcacggaagacgaagccaaccttgctgaactcga ggcagggcacccactttgagcggatcaggtagtcgacctgtttcaggagg gcctccgtggataggggtggcaggtaagacagggtctcgaacttcttgat gccctcaattggccacacctgcatgcacctgatccttccgccattgctga cgctgctgaggctgccgctggagcggcggccgacggggagaccggctgtg gacttgagcccctggaagggtgcgacggtggtagccgaggaagccatcac ggcgggggccatggtaatgtattatctggaggagaggaggatg
Download
page-top