Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ577837
Length 906 bp
Fasta Format > rwhpc17b03
ctgcagctcatcggaaaagcatacaacctcatgattaccagtacaatagt attgccagactatatggctataacattgtagtacacagtttatttatcct cggcggcttatttcctgtgcacctcaattctcagaaagcacgtcttgacc ctcttgtagactgcatcagtgatgcacattattttatgaagatagagaaa gatttctacacaggggcaacgagcacctcatccccgacatcagtgtgatc tttaactggcaggtcggtattcttatcaaaggggaatggctccagttttg gctgcgctgctttcaggatcatttcaattggcatttctggctttgatctt tccaaaggcgccactggatcaacacttgggtcatgacccaggttagcatg cattttctcaacaaaagtttggaaagtggcatagttctgtccctccagta gctcattcgataaccggaggtaggtgaatccaaacagtttgtgctcagga gggccattcttgttgatgcctttcggcctcgcattcctgagtattgtgtt gtaagcagtggcatcatatcgaccgagtgcgttttcgcacgccacatgta aaccctctctccatccagcactcagcacctgttggactagttcttctggt gcgctcttcgcctcttcgctttgctcggagtccctcatctctgcacaagt gaagttcatgctagcatgatgccttgtgagcatgcgtgctatggttctgt agccgtctctgtcatctaagttgtagtacccagctgtgagctcggctgca tggtttggaaccctgtaccaccagtgaatgccananattttgattgccag ctgcaccctgcatcccaagaaaaaccttgtttgcttcnntccnaanatct tgtcac
Download
page-top