Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ577672
Length 850 bp
Fasta Format > rwhpc16d19
gcgagcaggttcatacaacacaacaggttgtaaaccaaacaccacacagc aaacattcaattcaaacagacagaaaacagataaagccactcgggcagat catcaggtcgcaatctcagctgctctagtactcatcaccctcatcaccat cctcaccctcgtcgaactcagcaccaacttcttcatagtccttctccagg gcagcgagatcctcacgggcctcagagaactctccctcctccatgccctc acccacgtaccagtggacgaaggcacgcttggcgtacatcaggtcgaact tgtggtcgatgcgggagaagacctcgacaacgctggtggagttggagatc atgcagacggccctctggaccttggcaaggtcgccgcctgggacaacgct gggtggctggtagttgataccacacttgaaaccagtggggcaccagtcca caaactggatggtgcgcttcgtcttgatggtggccacagcggcgttgaca tccttgggcacaacatcaccacggtacatgaggcagcaggccatgtactt gccgtggcgggggtcacacttggccatcatggaggaaggctcgaaggcgc tgttggtgatctcggcaacagagagctgctcatggtaagccttctcggct gagatcactggggcgtaggaggaaagcatgaagtggattcttgggtaggg caccaggttggtctggaactcgttgacatcaacattcagagcaccatcaa acctcagggaagcagtcagggatgagatgacctgagaaacgagcctgttg aggttggtgtatgttgggcgctcaatgtcaaggggagcggcggcagatgt
Download
page-top