Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ577558
Length 683 bp
Fasta Format > rwhpc15l19
atacatacacaaaatcatatagaacaaaaggtatgctccggtcagaaagc agagtcntacagcagagttttggacaanagtgaagttcacaaaagacctt catacgagataggccattgtttcaactcgtagtttaggccttgccggact cctcgcaacccggtggcctaaaggcgatgaagctgacgcactgcacctgg cgcaggttgtcgaagccgatgacacggacataggcgtcagggtactcctt cttgacctcctccacctcgttcagcacctgtgtggcgtcagtgcacccga acataggcagcttccacattgtccagtatcggccgtcgtantacccgggg gagctgttgtgctcacggaagacgaaaccaaccttgctgaactcgaggca gggcacccactttgagcggatcaggtagtcgacctgtttcaggagggcct ccgtggataggggtggcaggtaagacagggtctcgaacttcttgatgccc tcaattggccacacctgcatgcacctgatccttccgccattgctgacnct gctgaggctgccgctggagcggcggccgacggggagaccggctgtggact tgagcccctggaagggtgcgacggnggtagccgaggaagccatcacggcg ggggccatggtaatgtattatctggagganagg
Download
page-top