Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ577244
Length 865 bp
Fasta Format > rwhpc14g07
agtgctgaagtcgccaaatgcatttattattagggtatcacaagggaagc aataacacttgaagtcttaggctttcgcattagcactctggaagctacag cctttgccacaatagttgccaaagaaaattagcgcacaccctcaatggtg ccagagctgaagtaaaccacagatctttcaatggtagaatgtcaagagtg agtgtggtcagaggaaaatgccatctctttcgctgatccagccgtgctgc tcttcttactatgttgaaaccgcaacggtgccctcaggaagagcagagat gtgcacaacaggtgtatgcgattttaatggtatgtcggagccggtaacct tcttctccgtcgacctgctcagcaccttcctcacctcatccgcaagcaca atgatcgagtcgtcttcatggcttatattggacagtgccttctccattga gaacaggtagtccctattatatccattagggccactggctgtagcaattt gccttgccatatcctccaaagcagcagggccaagatagtatttgttgcca actggatcaggagtggatacgaaaactaatacatccgtcacagctggttc cagagaatttccatccttgtagaaatccacagagatcttctggtcatact cgcattctcttctctccaagtactgcattgcttctcgctctttttctaga ccacctttgacacaataagcaattccccagcatatggcttcatcttcgga ttcaagggtgcaggtcctggccggatgctgtggtgtgcctctatggtcaa tgcaagcaagattaaacgttcgcttgtatcccttgatgaatcccaggatc ttctcgtcgaagtcg
Download
page-top