Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ577170
Length 777 bp
Fasta Format > rwhpc14b14
ctcatacattaagaaacattcatccttttctaccagtgttgccagagtac ataggtgaaaaagatagctcgcggcttcgtaattagtagcgctcgtaaat aatatcaataataatacaattacaacgtataactgtctgatcagacgaca agctaaaaacaaaacttgcagggcctagtggtgcttgttcagatcaattc ttcagtagtttcctcaacacgtcttcagcatgacgctccatctttggtaa agcccagtcatgctggatgatgtcgaggctgtctttctctgcgctcaagc tcattgctggattaaagcccattccaccacccatcgccatcatcttttgg gcatcatcagtagctgcataaacattttcttcaccaaggatgagactgaa aagacccctcaagccaaataaattgaggaagtaccatgaacggctgctaa catagctcacatcaacagtactcaggtctatcccattttgcagcattccc ctgaatcgttgagtcaatggaaaggggattttggctgcaacaaaaccgga aaagaagaagttcacccatgcaaatgtaagtgtctgtggaactatcatgg agagattcttcttcatcatatccatggccatgtttgggtccgaaaacata gccgcctgagccttctgggcatcctctttaggaacatgaagcaatcctgc ttccccgttggtgtaataaagcttgcgagccttgaaggccttggccggga tgaactgcgcgccgttcctcaggttcc
Download
page-top