Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ296366
Length 498 bp
Fasta Format > rwhsl8h16
attatcttgcatgcatcgatcgagatgcagcagctggctagtggcgacac ggatatacatacgacatacgtacgtataagggggcacacacacacacaca cacattcaagtaggtacacagacgtatggctccatgggctagctagctga cgtacggcgagggccagctagccgtagcattccacatatgatcagcactg cctgatgcacttgcaccggcggaggggcccgtcgcagttgccgccgcccc agcgttcctgcaggcagacctgcgcgcagttcttgtccgacacgcatggc cccttgaaccccgcgctgcgctgccggcagatcttcgcctccgcccccgg caccgccgcctnctgtgcgatgaggaggagaagcaggaccaaaaccacct gcgtcgccaccttcttggtccacatggtgagcggccgggctgggagcgag ctaaactctgcttgcgctacgtactggctttgttactaccggtggagc
Download
page-top