Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ580078
Length 652 bp
Fasta Format > rwhpc6k07
aagataaatggagaaggaaaacccaaagcaatgtcagagttgacaaaacc gcaatggcactttatatgtggcccgtggtgagtgagctgtttaggccttg ccggactcctcgcagcccggtggcttgaaggcgatgaagctgacgcactg cacctggcgcatgttgtcgaatccgatgatgcggacgtacgcgtcagggt actccttcttgacctcttccacctcgttgatcacctgtgtggcgtcggtg cacccgaacataggcagcttccacattgtccagtaccggccatcgtagta cccaggggatgcgttgtgctcacggaagatgaacccaaccttgctgaact cgaggcaaggcacccatttggagcggatcaggtagtcgacctgcttgagg agggcctccgtgctgagcggtggcaggtaggacagggtctcgaacttctt gatgccctcgatgggccacacctgcatgcacctgatccttccaccgttgc tgacgctgccgaggctagcgccgttggagcggcggctgacggggaggccg gcggtggacttgagcccctggaaaggagcgacggaggtggccgacgaggc catcacggtgggggccatggctgtgctatgtaggtatatagcttgctagg ag
Download
page-top