Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ579786
Length 864 bp
Fasta Format > rwhpc5g02
caatgtactgtcctgtaaatcatcaggcaaaaggggagctacaagcctca ttcatacacacttggaaaaccagcgaaaaggagcatgcatcgcgatgtgc ggctgttctgggtggagacgagagtttctaaagagcggaaggtttcattt attcaaaacatccagaggagcagctgcccttcgaatgtggatttacgcca ggcatgagtaggccaacgccttctcctctgacagctcctgggcggtcgca tccatcttcttcctcgagaactcatcgatcgggagcccttgaacaattgt ccattcaccaccactgcacgttactgggaaggagtagataagaccagcag gcacaccgtatgaaccatcagagtacacacccatggaaacaaatgttccc tcagcggttcccagaacccagtcacggatgtgatcacaagctgagctggc agcagagagagcactggagagcttcctcgctttgatgattgcagcaccac gctgctggacagtggcaatgaactccccatttagccattaatcatcttga acaagttcacgaacaggcttctctccactgggagtcttcacagtggcatg gttaacatcaggatactgactggacgagtgattaccccagataatagcat tcttaacgtcagaaacttggacaccaagtctctcagaaatctgaccgagt gccctgttgtggtctaggcgggtcaaacaactgatgttcttctcagggat agatggagcaaactccttcaggatgagagcattggtgtttgctgggttgg caacaaccaaaaccttgcaattgggggctgcatgagcttcaagagcagat gcttgagctttgta
Download
page-top