Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ579522
Length 760 bp
Fasta Format > rwhpc4a13
tgcatatacatagccaccgattgcattcacatacgagcacgctttctcga gccatgttgttacatgaacatggacatacacatattcttaggaacaagta agaaagacaaatggagaaggaaaacccaaagcaatgtcagagttgacaaa actgcaatggcactttatatgtggcccgtggtgagtgagctgtttaggcc ttgccggactcctcgcagcccggtggcttgaaggcaatgaagctgacgca ctgcacctggcgcatgttgtcgaatccgatgatgcggacgtacgcgtcag ggtactccttcttgacctcctccacctcgttgatcacctgtgtggcgtcg gtgcacccgaacataggcagcttccacattgtccagtagcggccgtcgta gtacccgggagacgcattgtgctcacggaagatgaacccgaccttgctga actcaaggcaaggcacccacttggagcggatcaggtagtccacctgcttg aggagggcctccgtgctgagcggtggcaggtaagacagggtctcgaactt cttgatgccctcgatgggccacacctgcatgcacctgatccttccaccgt tgctgacgctgccgaggctagcgccgttggagcggcggctgacggggagg ccggcggtggacttgagcccctggaaaggagcgacggaggtggccgacga ggccatcacggtgggggccatggctgtactatgtaggtatatagcttgct aggaggaggc
Download
page-top