Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ579285
Length 795 bp
Fasta Format > rwhpc2p20
gagcaggttcatacaacacaacaggttgtaaaccaaacaccacacagcaa acattcaattcaaacagacagaaaacagataaagccactcgggcagatca tcaggtcgcaatctcagctgctctagtactcatcaccctcatcaccatcc tcaccctcgtcgaactcagcaccaacttcttcatagtccttctccagggc agcgagatcctcacgggcctcagagaactctccctcctccatgccctcac ccacgtaccagtggacgaaggcacgcttggcgtacatcaggtcgaacttg tggtcgatgcgggagaagacctcgacaacgctggtggagttggagatcat gcagacggccctctggaccttggcaaggtcgccgcctgggacaacgctgg gtggctggtagttgataccacacttgaaaccagtggggcaccagtccaca aactggatggtgcgcttcgtcttgatggtggccacagcggcgttgacatc cttgggcacaacatcaccacggtacatgaggcagcaggccatgtacttgc cgtggcgggggtcacacttggccatcatggaggaaggctcgaaggcgctg ttggtgatctcggcaacagagagctgctcatggtaagccttctcggctga gatcactggggcgtaggaggaaagcatgaagtggattcttgggtagggca ccaggttggtctggaactcgttgacatcaacattcagagcaccatcaaac ctcagggaagcagtcagggatgagatgacctgagaaacgagcctg
Download
page-top