Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ579189
Length 429 bp
Fasta Format > rwhpc2i11
gatatatgttcagtagcaaacattatcattattggcttgcaagctcaagt cagggggaggaaacacagtagcagctgctccaccacaaaattactagcat agtacacataataaacacaggagagaaaaaaaggagtctcttcatcttcg ctgtcttactccacgccgaaaggagccacgtcgagatcttgcttaggcag acttcacggtggcggcgttgatgatgtcgatgaactcaggcttcaaggaa gctccaccaacgaggaaaccatcgacgtcgggctgcgcggccaactcctt gcagcttgcgccagttacagatcctccatagatgatccgcgtggattcag caacctcggggctcacattggtcttgagccagtccctcagattggcatgg acttcctgtgcctgagccggtgatgcaac
Download
page-top