Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ579134
Length 892 bp
Fasta Format > rwhpc2e08
cttcagagaaaacaagttgattctaatcaggtgtcaaattgtttcactct tgcagcaaatgtactgtcctgtaaatcatcaggcaaaaggggagctacaa gcctcattcatacacacttggaaaaccagcgaaaaggagcatgcatcgcg atgtgcggctgttctgggtggagacgagagtttctaaagagcggaaggtt tcatttattcaaaacatccagaggagcagctgcccttcgaatgtggattt acgccaggcatgagtaggccaacgccttctcctctgacagctcctgggcg gtcgcatccatcttcttcctcgagaactcatcgatcgggagcccttgaac aattgtccattcaccaccactgcacgttactgggaaggagtagataagac cagcaggcacaccgtatgaaccatcagagtacacacccatggaaacaaat gttccctcagcggttcccagaacccagtcacggatgtgatcacaagctga gctggcagcagagagagcactggagagcttcctcgctttgatgattgcag caccacgctgctggacagtggcaatgaactccccatttagccattcatca tcttgaacaagttcacgaacaggcttctctccactgggagtcttcacagt ggcatggttaacatcaggatactgactggacgagtgattaccccagataa tagcattcttaacgtcagaaacttggacaccaagtctctcagaaatctga ccgagtgccctgttgtggtctaggcgggtcaaacaactgatgttcttctc agggatagatggagcaaactccttcaggatganagcattggtgtttgctg ggttggcaacaaccaaaaccttgcaattggggggctgcatga
Download
page-top