Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ578788
Length 863 bp
Fasta Format > rwhpc1o02
cagcaatgtactgtcctgtaaatcatcaggcaaaaggggagctacaagcc tcattcatacacacttggaaaaccagcgaaaaggagcatgcatcgcgatg tgcggctgttctgggtggagacgagagtttctaaagagcggaaggtttca tttattcaaaacatccagaggagcagctgcccttcgaatgtggatttacg ccaggcatgagtaggccaacgccttctcctctgacagctcctgggcggtc gcatccatcttcttcctcgagaactcatcgatcgggagcccttgaacaat tgtccattcaccaccactgcacgttactgggaaggagtagataagaccag caggcacaccgtatgaaccatcagagtacacacccatggaaacaaatgtt ccctcagcggttcccagaacccagtcacggatgtgatcacaagctgagct ggcagcagagagagcactggagagcttcctcgctttgatgattgcagcac cacgctgctggacagtggcaatgaactccccatttagccattcatcatct tgaacaagttcacgaacaggcttctctccactgggagtcttcacagtggc atggttaacatcaggatactgactggacgagtgattaccccagataatag cattcttaacgtcagaaacttggacaccaagtctctcagaaatctgaccg agtgccctgttgtggtctaggcgggtcaaacaactgatgttcttctcagg gatagatggagcaaactccttcaggatgagagcattggtgtttgctgggt tggcaacaaccaaaaaccttgcaattgggggctgcatgagcttcaagagc agatgcttgagct
Download
page-top