Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ578766
Length 763 bp
Fasta Format > rwhpc1m19
tgtgcatgtgcatatacatagccaccgattgcattcacatacgagcatgc tttctcgagacatgttggtacatgaacatggacatacacatattcttagg aacaaacaagaaagataaatggagaaggaaaacccaaagcaatgtcagag ttgacaaaaccgcaatggcactttatatgtggcccgtggtgagtgagctg tttaggccttgccggactcctcgcagcccggtggcttgaaggcgatgaag ctgacgcactgcacctggcgcatgttgtcgaatccgatgatgcggacgta cgcgtcagggtactccttcttgacctcttccacctcgttgatcacctgtg tggcgtcggtgcacccgaacataggcagcttccacattgtccagtaccgg ccatcgtagtacccaggggatgcgttgtgctcacggaagatgaacccaac cttgctgaactcgaggcaaggcacccatttggagcggatcaggtagtcga cctgcttgaggagggcctccgtgctgagcggtggcaggtaggacagggtc tcgaacttcttgatgccctcgatgggccacacctgcatgcacctgatcct tccaccgttgctgacgctgccgaggctagcgccgttggagcggcggctga cggggaggccggcggtggacttgagcccctggaaaggagcgacggaggtg gccgacgaggccatcacggtgggggccatggctgtgctatgtaggtatat agcttgctaggag
Download
page-top