Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ578725
Length 829 bp
Fasta Format > rwhpc1k03
ctgctaaaaccttcacaatcattaagttataagcacaaactgttttattt gttcactcaaatacacacagcaaagtgggacggagttccgatgaactgca gctcatcggaaaagcatacaacctcatgattaccagtacaatagtattgc cagactatatggctataacattgtagtacacagtttatttatcctcggcg gcttatttcctgtgcacctcaattctcagaaagcacgtcttgaccctctt gtagactgcatcagtgatgcacattattttatgaagatagagaaagattt ctacacaggggcaacgagcacctcatccccgacatcagtgtgatctttaa ctggcaggtcggtattcttatcaaaggggaatggctccagttttggctgc gctgctttcaggatcatttcaattggcatttctggctttgatctttccaa aggcgccactggatcaacacttgggtcatgacccaggttagcatgcattt tctcaacaaaagtttggaaagtggcatagttctgtccctccagtagctca ttcgataaccggaggtaggtgaatccaaacagtttgtgctcaggagggcc attcttgttgatgcctttcggcctcgcattcctgagtattgtgttgtaag cagtggcatcatatcgaccgagtgcgttttcgcacgccacatgtaaaccc tctctccatccagcactcagcacctgttggactagttcttctggtgcgct cttcgcctcttcgctttgctcggagtccctcatctctgcacaagtgaagt ttcatgctagcatgatgccttgtgagcat
Download
page-top