Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ576349
Length 722 bp
Fasta Format > rwhpc10k20
agttgattctaatcaggtgtcaaattgtttcactcttgcagcaaatgtac tgtcctgtaaatcatcaggcaaaaggggagctacaagcctcattcataca cacttggaaaaccagcgaaaaggagcatgcatcgcgatgtgcggctgttc tgggtggagacgagagtttctaaagagcggaaggtttcatttattcaaaa catccagaggagcagctgcccttcgaatgtggatttacgccaggcatgag taggccaacgccttctcctctgacagctcctgggcggtcgcatccatctt cttcctcgagaactcatcgatcgggagcccttgaacaattgtccattcac caccactgcacgttactgggaaggagtagataagaccagcaggcacaccg tatgaaccatcagagtacacacccatggaaacaaatgttccctcagcggt tcccagaacccagtcacggatgtgatcacaagctgagctggcagcagaga gagcactggagagcttcctcgctttgatgattgcagcaccacgctgctgg acagtggcaatgaactccccatttagccattcatcatcttgaacaagttc acgaacaggcttctctccactgggagtcttcacagtggcatggttaacat caggatactgactggacgagtgattaccccagataatagcattcttaacg tcagaaacttggacaccaagtc
Download
page-top