Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ576314
Length 767 bp
Fasta Format > rwhpc10i12
acttaaacataaggatggggcaatgtatatatgcccgaacgaaaaactgc agaacgatactagaatccaccgtacaatgaaagacacattattcaagcag aatagtaggcgatctaaatctatcatttagtcgacctcctcaatcttggg ccctgggccgctgctgccgcctgcggcactggccggagcatcctcatcca tgccaccaggcatttcagcgccggcaccctggtacatcttggcgatgatg gggttgcaaatgccctccagctctttcctcttgtcatcaaactcttcagc ctcggcgagctggttgttgtcgagccaggtgatggcaccatcgatagcat cctcgatcttcttcttgtcggcctctgggagcttggaggcgatcttgtca tccttgatggtgttacgcatgttgtaagcgtagttctccagggcgttctt ggagtccaccttcttcttgtgctcctcgtcctcagccttgtacttctcgg cctcctgcaccatcttctcgatgtcctccttgctcagccgccccttgtcg ttggtaattgtgatcttgttcttctgtccggtggtcttgtcctccgccga gacattcaggataccgttggcatcaatgtcaaagcacacggtgatctggg ggacacccctgggcgccggtgggatcccgganagctcgaacttgccgagc aggttgttgtccttggtcctcgccctctcgccctcatanacctggatgag cacgccngggctggttg
Download
page-top