Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ576280
Length 766 bp
Fasta Format > rwhpc10f21
aaacgttgctcaatggaaaaaagaccaagagcagagttgttcagacttct atagcaacaattccatcaaccaaaataaacttttatatcagcaacagcaa cagaaattctgtcgcaattaatttgggaaggggcacaagaaactgctaca ggcaatggacatgaaacccgaaggaggaacagtgtcataatctgcatttt atttcatgcattgtgatgctacaaggagcaaaagctgtggcgcatatcaa ggaagatgtcttcaaggaagggttctctcatagagaggaagggctcccag tgctttacgctctgctgcctcctttttcaccagagccagcatgtcgctca aatagcttttgaatggtgtctgtagtgcccggacgtcgtcggggaggtac tggtgcttcatggagaggtccatggcgcgcttgagacgctggtggcgggc gtcgaccacctcccggggcagcctgcagagcgcctccttgatgtccagat cgaagtaggggtcatacaggtcgtcgtacctcaggccgtagttcttgagg cggttggagatggtgagcatgtggatgcgggccagcgggttgcggcgcgg gttcacgaaccacgacgagaacgcggacagcatcgacgtcatcctgggcg acggcggcggcggcggcggcgatcccctttctcgtctcctctcttcttcg gtgtttgtgatttgggggaggaggangagggcctcnngccnaattccctg cancccnggngatcca
Download
page-top