Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ576269
Length 546 bp
Fasta Format > rwhpc10f04
ctaaagacatcccaaggtggtttgcagtactcattgcacagatacttagg tctcaaacatattaaatccgcaaaattcgacctaaaagcacataagataa gtaatccttagcataaaagattccacaggagaactggaattgaactgctt agtcgaacaagctgaagcccatgtcatcatcgctctcttccttagcctcc tcctttttctcttctttcttctcttcagcggcagcagcaccaccagcagc cggggcagcagcagcagcagctggagcaccacctccaccagatccgacgg aaaggatgaggtcatcgacgctcctcttctccaggagcttggcgaagagc gcgggccagtaggcctcaaccttgattccggcagccttcaccaccgtcgc gatcttctcagaagtgatggggatcccgtcatcgtggaggatgagggcgg caagggtgcaggcgacctcgctggaagacatggcgacggattctcaccgg agcagatctgcgatcttgggaggcgatggaagtggaggcgcaggag
Download
page-top