Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ576214
Length 556 bp
Fasta Format > rwhpc10b08
gttgcaacttaacttacaaaggacaaacacagttacacaattacatatca gtaagtagcattctaaaaaatgacttggatcgtccagtccactgcaattc cacggccattgatagccctatgatgtaagcttctgtgagacgagagcctt ctggcagctgctgcagcaacggttgtcgccgctgtcgatgttcttgctgt ccaggtaccagccggcgagcatgtcgaagacgagaccagcgccgacaccg acggccaggtcaatggtgtaatgccctctgcacgcaagcagcctgacgaa ctgcagcaggttgagcgtgtcgtagagcaccgccagcctgcgccgtccca cgcggcgcatgtcgatggacgcgatcaccgctccggcgacgtgcccagaa tagaagaggaaaaaggacacgttccccacggggaagtccatcccggagcc caggaactccgccggcaggggcagctgcgtggagcacccgagcaggccac ggcaggtgaacatcatgagcgtggcgatggcggcacgcggccgctgctcg gcgagg
Download
page-top