Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ576212
Length 661 bp
Fasta Format > rwhpc10b02
aagtggcatcagtttcccttaacgattacagcaattttctcttgttctaa tcagtacatctactgtcagacaaacagatactgcataattaagattgcct ctggtcgtctcatgtgcccattcgcccaaaaccatgagtcagttcatgac gattttacgcgatcaccgatgtctcgattccaactttgcttgacttcctg acgtcctcatccttcacagcctcaacccacagttccggaaacgcttcctt catgttgtgaaggctctccaaggcatggtcagcacctttaatcctttcag aagttccaaccaggacagtgtgcattccgatttgcttccctgcctggatg ttcctgacactatcatcgaaaaatatctggtacgtgtttcgtagccagtg agcacaccatacaacatgaggtacctatgaatctctgaaaattgaccatt gagttatttggtacttacagtagtctgaggattgatgtcggcaagcttga gggcatgcagcattgcatctatattcggtttgcacaggattggcgacctt ggcagctcaaccccaggctctggatgagccaggtgcttcattatatcgaa gatctcaactttgttggctggcgcaggagtgggcgatggcgggttcaatg tctcaaagcac
Download
page-top