Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ685134
Length 806 bp
Fasta Format > whpc19m18
gagtgagcacgcaagccagtgtttgtagccagcagccacaatggccggga acatgctagccaactatgtccaagtctacgtcatgctcccgctggacgtc gtgagcgtcgacaacaaattcgagaagggcgacgagatcagggcgcagct gaagaagctgacggaggccggcgtggacggcgtcatgatagacgtctggt gggggctggtggagggcaagggccccaaggcgtacgactggagcgcctac aagcaggtcttcgacctggtgcacgaggccgggctcaagctgcaggccat catgtcattccaccagtgcggtggcaacgtcggcgacgtcgtcaacatcc ccatcccacagtgggttcgcgacgtcggcgccaccgaccccgacattttc tacaccaaccgcggcgggacgaggaacatcgagtacctcacccttggagt ggacgaccagcctctcttccatggaagaactgccgtccagatgtatgctg attacatggcgagcttcagggaaaacatgaagaagttcttggatgccggt accatcgtggacattgaagtgggacttggcccagctggagagatgaggta cccatcgtatcctcagagccaaggatgggtcttcccaggcatcggagaat tcatctgttatgataagtacctggaagcagacttcaaagcagcagcggcg aaggctggccaccctgagtgggaattgcctgacgatgctggagagtacaa cgacactcccganaaaacccaattcttcaaggacaacggaacatacctca canaga
Download
page-top