Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ685011
Length 891 bp
Fasta Format > whpc19e20
tcttgctgagctgagcacgccccttctctctcaactttgggctcgaggca atggcggcgctcgctccgacgaagatgctcggcacccggctcaacttcgc cggctcctccaggtacgccacagcggcaccaactgctggcgcacagaaga tcgtctccctctttgatcgcttcaagaagaagcctgccccgaagccgaag cccgcccccgtggccacctcgagcgtaggcatcgacgacgagctcgccaa gtggtacggccctgacaggaggatctacttgcccaacggactccttgacc ggtcggaggtgccggagtacctcaacggagaggttcccggagactacggc tatgatccttttggtctgggcaagaagccagaggacttcgccaagtacca ggcctttgagctcatccatgccaggtgggccatgctcggcgccgccggat tcatcatccccgaggcgctcaacaagttcggcgcaaactgcggtcccgag gccgtttggttcaagactggcgcccttctccttgacggcaacaccctcaa ctacttcggcaacagcatccccatcaacctgatcctcgccgtcgtcgccg aggtcgtcctcgtcggaggcgccgagtactacaggatcaccaacggactg gaatttgatgacaagctccaccccggtggcccattcgacccgctcggcct cgccaccgaccccgaccaggcggcgctgctcaaggtgaaggagatcaaga acggacggctggccatgttctccatgctgggcttcttcatccaggcctac gtcaccgggcgagggcccctttgagaacctgtgcgcgcacctcagcgacc ccttcggcaacaacctgctcaccgtcatctccggcgccgcc
Download
page-top