Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ684756
Length 622 bp
Fasta Format > whpc18f06
ggggatcgccgccgccgccgccgccgccgcccaggatgacgtcgatgctg tccgcgttctcgtcgtggttcgtgaacccgcgccgcaacccgctggcccg catccacatgctcaccatctccaaccgcctcaagaacttcggcctgaggt acgacgatctgtacgacccctacttcgatctggacatcaaggaggcgctc ggcaggctgccccgggaggtggtcgacgcccgccaccagcgcctcaagcg cgccatggacctctccatgaagcaccagtacctccccgacgacgtccggg cactgcagacaccattcaaaagctatttgagcgacatgctggctctggtg aaaaaggaggcagcagagcgtaaagcactgggagcccttcccctctacga gagaacccttccttgaagacttcttttcatgatatgcgccacaatttttg ctcctcgtagcatcataatgcatgaaataaaatgcagattatgacactat tcctacttccggtttcatgtccattgcctgtagcagtttctcgtgcccat tcccaaattaattgcgacagaatttctgttgctgttgctgatataaaagt ttattttggttgaaaaaaaaaa
Download
page-top