Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ684634
Length 865 bp
Fasta Format > whpc17o02
gtgtcatgaccgtgctgatcccaaggaacacgacaatccccaccaagaag gagcaggtcttctccacctactctgacaaccagcccggcgtgctcatcca ggtgtatgagggcgagagggcgaggaccaaggacaacaacctgctcggca agttcgagctctccgggatcccaccggcgcccaggggtgtcccccagatc accgtgtgctttgacattgatgccaacggtatcctgaatgtctcggcgga ggacaagaccaccggacagaagaacaagatcacaattaccaacgacaagg ggcggctgagcaaggaggacatcgagaagatggtgcaggaggccgagaag tacaaggctgaggacgaggagcacaagaagaaggtggactccaagaacgc cctggagaactacgcttacaacatgcgtaacaccatcaaggatgacaaga tcgcctccaagctcccagaggccgacaagaagaagatcgaggatgctatc gatggtgccatcacctggctcgacaacaaccagctcgccgaggctgaaga gtttgatgacaagaggaaagagctggagggcatttgcaaccccatcatcg ccaagatgtaccagggtgccggcgctgaaatgcctggtggcatggatgag gatgctccggccagtgccgcaggcggcagcagcggcccagggcccaagat tgaggaggtcgactaaatgatagatttagatcgcctactattctgcttga ataatgtgtctttcattgtacggtggattctagtatcgttctgcagtttt tcgttcgggcatatatacattgccccatcttatgtttaagttgatattga aacacgattatttag
Download
page-top