Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ684461
Length 781 bp
Fasta Format > whpc17b24
agacagcacgaggaaggcgagccaaccaccaccgccgcgagactagcacc acgagcgagctcggccgattccgattccgtctgcgctattaaggtttgtt tggaggaaggggaggaggttcggaggtggagctgagagagagaccggaga tggcggcttccgcgaggcagggggagagggcgaccagcttcgccatggcc tgcagcctgctcagccgctacgtccgccagaacggcgccgccgcggccga gctcggcctcggaatcaacaagggtgaggccgaggctcacaggacggcgg acaccaagagccctttgcctggggcggagggcgaggaggccggcaggaag aaggagaccatggagctcttcccgcagagcgccggcctgcaggacgccgc cgcccctgacgctactagggaggaagacaagagccagctgaccatcttct atggtgggaaggtgctcgtgttcaacgatttcccagccgacaaggccaag ggcctgatgcagttggctggcaagggcagcccggttgctcanaacgtctc tgcgaccacaactgctgcagacaccgccaaggtccagacggccgtgctgg ccccggcaagtantttgcctantgatccggttgttgctcctaantctgct cntccnaatgcttctgatctgccaattgctanaaaggcgtcacttcaccg attccttganaananaaaggatcntctgcatgcaaaggcaccatatcaan cttctccttctgatgcaacaccantcaanaa
Download
page-top