Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683874
Length 798 bp
Fasta Format > whpc14g07
ccccatccgtccgtccgtcccggggaggagaggagacgcgggcgaggcaa gaggagagtcaaatccccatcttgctcccccccccgcgccgccgacccca cccgcggcattctctccggcgtccctcctccggccagggggaaaagcagc agcaggatggtgctgtgggtcttcgggtatgggtccctgatctggaaccc cggattcgacttcgacgagaagatcctgggattcatcaagggatacaagc gaacgtttaatcttgcttgcattgaccatagaggcacaccacagcatccg gccaggacctgcacccttgaatccgaagatgaagccatatgctggggaat tgcttattgtgtcaaaggtggtctagaaaaagagcgagaagcaatgcagt acttggagagaagagaatgcgagtatgaccagaagatctctgtggatttc tacaaggatggaaattctctggaaccagctgtgacggatgtattagtttt cgtatccactcctgatccagttggcaacaaatactatcttggccctgctg ctttggaggatatggcaaggcaaattgctacagccagtggccctaatgga tataatagggactacctgttctcaatggagaaggcactgtccaatataag ccatgaagacgactcgatcattgtgcttgcggatgaggtgaggaaggtgc tgagcaggtcgacggagaagaaggttaccggctccgacataccattaaaa tcgcatacacctgttgtgcacatctctgctcttcctgagggcaccgtt
Download
page-top