Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683801
Length 811 bp
Fasta Format > whpc14b14
acggcgcgcagttcatcccggccaaggccttcaaggctcgcaagctttat tacaccaacggggaagcaggattgcttcatgttcctaaagaggatgccca gaaggctcaggcggctatgttttcggacccaaacatggccatggatatga tgaagaagaatctctccatgatagttccacagacacttacatttgcatgg gtgaacttcttcttttccggttttgttgcagccaaaatcccctttccatt gactcaacgattcaggggaatgctgcaaaatgggatagacctgagtactg ttgatgtgagctatgttagcagccgttcatggtacttcctcaatttattt ggcttgaggggtcttttcagtctcatccttggtgaagaaaatgtttatgc agctactgatgatgcccaaaagatgatggcgatgggtggtggaatgggct ttaatccagcaatgagcttgagcgcagagaaagacagcctcgacatcatc cagcatgactgggctttaccaaagatggagcgtcatgctgaagacgtgtt gaggaaactactgaagaattgatctgaacaagcaccactaggccctgcaa gttttgtttttagcttgtcgtctgatcagacagttatacgttgtaattgt attattattgatattatttacgagcgctactaattacgaagccgcgagct atctttttcacctatgtactctggcaacactggtagaaaaggatgaatgt ttcttaatgtatgagctgctttgggtaatccaagtttgtcattctgtttg gaaaaaaaaaa
Download
page-top