Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295872
Length 464 bp
Fasta Format > rwhsl5n23
ttaagncttgatatactagtaaatnaactgtaaagatcgtcggcagaacc actgacgatgacaacgacgaccacgaccactactaccgttgaaacagcag cagagacacatgtaaccccgtactacatgtgtacgttattcaaaccttca acagagagaagcaaaggtgcgagcttgcagcgcatgtcttgccgccgccc gcgcgcgccctacggcgggcaacacatgccgcaacacgcccagccatata tggggcaagtgcggcagttgcagtttctgtagccgcaccacaggagccgg cgtgccccgccgcccgccgccgctatctgcgtggccatcagcaggaccac gaggagcatcacgcaggagacgaacatcttgttcctcagaagtgctgcca tgccgccgccggaggccatcgcttcagctgggtggtgagagtgagacgaa gtgctcggcgttac
Download
page-top