Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687035
Length 747 bp
Fasta Format > whpc8i13
aagcgaagaggcgaagagcgcaccagaagaactagtccaacaggtgctga gctgctggatggagagagggtttacatgtggcgtgcgaaaacgcactcgg tcgatatgatgccactgcttacaacacaatactcaggaatgcgaggccga aaggcatcaacaagaatggccctcctgagcacaaactgtttggattcacc tacctccggttatcgaatgagctactggagggacagaactatgccacttt ccaaacttttgttgagaaaatgcatgctaacctgggtcatgacccaagtg ttgatccagtggcgcctttggaaagatcaaagccagaaatgccaattgaa atgatcctgaaagcagcgcagccaaaactggagccattcccctttgataa gaacaccgacctgccagttaaagatcacactgatgtcggggatgaggtgc tcgttgcccctgtgtagaaatctttctctatcttcataaaataatgtgca tcactgatgcagtctatgagagggtcaagacgtgctttgtgagaattgag gtgcacaggaaataagccgccgaggataaataaactgtgtactacaatgt tatagccatatagtctggcaatactattgtactggtaatcatgaggttgt atgctttttcgatgagctgcagttcatcggaactccgtcccactttgctg tgtgtatttgattgaacaaataaaacagtttgtgcttaaaaaaaaaa
Download
page-top