Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ687012
Length 665 bp
Fasta Format > whpc8h01
ctcacgggtcaagaccatcacccttgcaggtggagtcgtctgacaccatc ganaacgtgaaggccaagatccaggacnaggagggcattcccccggacca ncagcgccttatcttcnctggcaagcanctggaggacggtcgcacccttg ccgactacaacatccagaaggaatccaccctccacctggtgctccgcctg cgtggtggcatgcatatcttcttgaagaccctcaccggcaagaccntcac tctggaggttgatagctccgacaccattgacaacgtcnaggntaagatcc aggacaaggagggcattcccccggaccagcancgccttatcttcgcaggc aagcagctggaggatggtcgcacccttgccgactacaacatccntaanga gtccacccttcacctggngctccgcctccgtggtggtatgnagattttcg tgaanaccctcaccggcaagactatcacccttgaggttgagagctctgac accatcgacaacgtcaagaccaanatccaggacaaggagggcattccccc ngaccancagcgcctcatcttcgccggcaagcagctggaggatggccgca cccttgcggactacaacatcnagaaggagtccaccctccacctggtgctc cgcctccgcggtggt
Download
page-top