Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ686858
Length 166 bp
Fasta Format > whpc7m24
agattggctcanggccccagagatcatgcaccagcacnntcngctgcagc tccagctccagcagcagcggcaccaaagaaggccaaggccaagaagtgaa ggtctgacatgaagctttagctttctggtatcatgaagggttagcctgat tttggagcatctgaag
Download
page-top