Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ686705
Length 415 bp
Fasta Format > whpc7d04
cccgtggtcactacaccattggcaaggagattgttgacctatgcctggac cgtatcaggaagcttgcngacaactgcactggtcttcagggattcctcgt cttcaatgctgttggaggtggaactggctctggccttggttctcttctcc tggagcggctctctgttgactatggaaagaagtccaagcttgggttcaca gtgtacccatcccctcaggtctccacctctgttgtcgagccatacaacag tgtcctgtccacccactctctccttgagcacactgatgtggctgtcctcc ttgacaatgaggccatctatgacatctgccgccgctcccttgacattgag cgcccaacatacaccaacctcaacagggctcgtttctcaggtcatctcat ccctgactgcttccc
Download
page-top