Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ686569
Length 803 bp
Fasta Format > whpc6i20
catcctcccttcttgctgagctgagcacgccccttctctctcaactttgg gctcgaggcaatggcggcgctcgctccgacgaagatgctcggcacccggc tcaacttcgccggctcctccaggtacgccacagcggcaccaactgctggc gcacagaagatcgtctccctctttgatcgcttcaagaagaagcctgcccc gaagccgaagcccgcccccgtggccacctcgagcgtaggcatcgacgacg agctcgccaagtggtacggccctgacaggaggatctacttgcccaacgga ctccttgaccggtcggaggtgccggagtacctcaacggagaggttcccgg agactacggctatgatccttttggtctgggcaagaagccagaggacttcg ccaagtaccaggcctttgagctcatccatgccaggtgggccatgctcggc gccgccggattcatcatccccgaggcgctcaacaagttcggcgcaaactg cggtcccgaggccgtttggttcaagactggcgcccttctccttgacggca acaccctcaactacttcggcaacagcatccccatcaacctgatcctcgcc gtcgtcgccgaggtcgtcctcgtcggaggcgccgagtactacaggatcac caacggactggaatttgatgacaagctccaccccggtggcccattcgacc cgctcggcctcgccaccgaccccgaccaggcggcgctgctcaaggtgaag gagatcaagaacggacggctggccatgttctccatgctgggcttcttcat cca
Download
page-top