Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ686310
Length 388 bp
Fasta Format > whpc5g06
ttggaatttggggatgcaaggactgtggcaaggtcanggctggcggcgcc tataccatgaacactgntagtgcagtcaccgtcaggagcacgatccgtcg cttgagggagcagaccgaagcatgattgccctactgttgtcttgaggaat ccnggggttctgtantggagtgaagacttaacaatctctgtattttggct atcgagcganggatatctgttantaattttggttctgattttacgatctt tgaaacttgaaagtatgtccctacagctgcctgttatgcgttatgccaac ctatttgtatttttgtgacacgtctctcactctctacccctctgcacccc aagtcaatcttatatgataangtttttatctctttttt
Download
page-top