Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ686306
Length 805 bp
Fasta Format > whpc5g02
gaatctaccccccggctccaatggcggcgaaggaaccgatgcgcgtgctc gtcaccggcgccgcaggacaaatcggatatgctcttgttcccatgattgc caggggagttatgcttggtgcagaccagcctgttattctgcatatgctgg atattgaatttgctgctgaagctcttaaaggcgtcaagatggagttgatc gatgccgcatttccacttctcaagggagttgttgcaacaactgatgttgt tgaggcttgcactggtgtgaatgttgcggttatggttggtggattcccca ggaaggaaggaatggaaaggaaggatgttatgacgaaaaatgtttcaatc tacaaagctcaagcatctgctcttgaagctcatgcagcccccaattgcaa ggttttggttgttgccaacccagcaaacaccaatgctctcatcctgaagg agtttgctccatctatccctgagaagaacatcagttgtttgacccgccta gaccacaacagggcactcggtcagatttctgagagacttggtgtccaagt ttctgacgttaagaatgctattatctggggtaatcactcgtccagtcagt atcctgatgttaaccatgccactgtgaagactcccagtggagagaagcct gttcgtgaacttgttcaagatgattaatggctaaatggggagttcattgc cactgtccagcagcgtggtgctgcaatcatcaaagcgaggaagctctcca gtgctctctctgctgccagctcagcttgtgatcacatccgtgactgggtt ctggg
Download
page-top