Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ686104
Length 709 bp
Fasta Format > whpc4e22
cttgcagagagatcgggtctgggaggatgacgacgggagggcgcgcggtg ctcctactgccgcttctggtggcctcggcgctgttcgcgcagatccgcgc gtcggatccgctgttccacgagtccttcgacgagggcttcgaggggagct gggtcgtctccggcaaggaagagtactcaggtgtatggaagcacgagaag agtgatggccatgaagactatggtctccttgtcagtgagccagccaggaa atatgccatagtcaaagagcttgatagccctgttactttgaaggatggga cagttgtcctgcagttcgaagtgaggcttcagaatggcctcgagtgtgga ggtgcttatcttaagtacattcgccctcaggaggctggatgggatgccaa ggaatttgacaatgacactccttacacaattatgtttggtcctgacaagt gtggttcaacgaacaaggttcacttcatcctgaagcacaagaaccccaag actggcaaatatgttgaacatcacctcaagtccccaccctctgtcccata tgacaagctctctcatgtctacacggctatcttgaagccggataacgagg tcagaattttggttgatggggaggagaagagcaaagcaaacttcctgtcc gctgacgattttgagccagcacttattccatcaaagaccattcctgaccc tgatgacaa
Download
page-top