Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ685838
Length 811 bp
Fasta Format > whpc2p20
tcgcctctctctcgcgcttccgagctttgtccttcgtcctcctcccccga cctctccagcagcgtagcgtagcgcccgcttccgccgttccgacccgccg ccatgagggagtgcatctcgatccacatcggccaggctggtatccaggtc gggaacgcgtgctgggagctctactgcctcgagcatggcattcagcctga tggacagatgcccggtgacaagactgttgggggaggtgatgatgctttca acaccttcttcagtgagactggtgctgggaagcatgtcccccgtgctgtc tttgttgatcttgagcccactgtgattgatgaggtgaggactggcactta tcgccagctcttccaccctgagcagcttatcagtggcaaggaggatgcag ccaacaactttgcccgtggtcactacaccattggcaaggagattgttgac ctatgcctggaccgtatcaggaagcttgcagacaactgcactggtcttca gggattcctcgtcttcaatgctgttggaggtggaactggctctggccttg gttctcttctcctggagcggctctctgttgactatggaaagaagtccaag cttgggttcacagtgtacccatcccctcaggtctccacctctgttgtcga gccatacaacagtgtcctgtccacccactctctccttgagcacactgatg tggctgtcctccttgacaatgaggccatctatgacatctgccgccgctcc cttgacattgagcgcccaaacatacaccaacctcaacaggctcgtttctc aggtcatctca
Download
page-top