Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ685746
Length 452 bp
Fasta Format > whpc2i11
ggcacaggaagtccatgccaatctgagggactggctcaagaccaatgtga gccccgaggttgctgaatccacgcggatcatctatggaggatctgtaact ggcgcaagctgcaaggagttggccgcgcagcccgacgtcgatggtttcct cgttggtggagcttccttgaagcctgagttcatcgacatcatcaacgccg ccaccgtgaagtctgcctaagcaagatctcgacgtggctcctttcggcgt ggagtaagacagcgaagatgaagagactcctttttttctctcctgtgttt attatgtgtactatgctagtaattttgtggtggagcagctgctactgtgt ttcctccccctgacttgagcttgcaagccaataatgataatgtttgctac tgaacatatatcagcaataatctttagctcttgttgctgtttaaaaaaaa aa
Download
page-top