Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ685242
Length 792 bp
Fasta Format > whpc1e20
cctcctccaacaccatggcccccactgtgatggcttcctcggccacctcc gtcgcacccttccagggtctcaagtccaccgcgggcctgcccgtcagccg ccgctccagcagcgccggcctcggcagcgtcagcaacggcggaaggatca ggtgcatgcaggtgtggccgattgagggcatcaagaagttcgagaccctg tcttacttgccacccctctccacggaggccctcctgaagcaggtcgacta cttgatccgctccaagtgggtgccctgcctcgagttcagcaaggttggct tcgttttccgtgagcacaacagctcccccgggtactacgatggtcgatac tggacaatgtggaagctgcctatgttcgggtgcaccgacgccacacaggt gctcaacgaggtggaggaggtcaagaaggagtaccctgacgcctatgtcc gcgtcatcggcttcgacaacctgcgccaggtgcagtgcgtcagcttcatc gccttcaggccaccgggttgcgaggagtctggcaaggcctaaactacgag ttgaaacaatggcctatgtatgaaggtcttttgtgaacttaacttttgtc caccactctgctggacgaccagagcatatttttcattctatatggtctgt gtgtgtatgtacgaacataggttctcgagcatgcatatgtaaattctaga accggctacacatatacaaaacctgtgtgatatttattatatacaaacac gcggaccattgtcttgctgttattaattcaggaaaaaaaaaa
Download
page-top