Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ685199
Length 845 bp
Fasta Format > whpc1b24
ctctcctccaccgcccagaccaccatcgagatcgattccctcttcgaggg catcgacttctacactaccatcacccgcgcccggttcgaggagctcaaca tggacctcttccgcaagtgcatggagcccgttgagaagtgcctccgggac gccaagatggacaagagcaccgtgcacgatgttgtcctcgtcggaggatc cacacgtatcccccgtgtgcagcagctcctccaggacttctttaacggga aggagctctgcaagagcatcaaccctgacgaggccgtcgcgtatggagcc gccgttcaggctgccatcctcactggcgagggcaacgagaaggtgcagga cttgctcctgcttgacgtcacaccgctctcgcagggcctggagacggccg gaggtgtcatgaccgtgctgatcccaaggaacacgacaatccccaccaag aaggagcaggtcttctccacctactctgacaaccagcccggcgtgctcat ccaggtgtatgagggcgagagggcgaggaccaaggacaacaacctgctcg gcaagttcgagctctccgggatcccaccggcgcccaggggtgtcccccag atcaccgtgtgctttgacattgatgccaacggtatcctgaatgtctcggc ggaggacaagaccaccggacagaagaacaagatcacaattaccaacgaca aggggcggctgagcaaggaggacatcgagaagatggtgcaggaggccgag aagtacaaggctgaggacgaggagcacaagaagaaggtggactccaagaa cgccctgggagaactacgcttacaacatgcgtaacaccatcaagg
Download
page-top