Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683499
Length 720 bp
Fasta Format > whpc12l13
ctctttctctctcgcaccgcaccgcaccgcaccgcgtcccctccctctcc tgtcgcgtgcgctcggccagcaaaagcttccacataaaggccaacaagag aaaccttaatctgttgggtgccagtcaaacctcaacaacaaagtttcatg tctgatctcgacgttactctgccatctgccttcgatccttttgctgaggc aaatgctgaggatgctggtgcaggccccggcgcaaaagattatgtgcatg tgcgcatccagcagcgcaacggcaggaagagtctgaccactgtccagggc ctgaagaaggagttcagctacaacaagatcctcaaggatctcaagaagga attctgctgcaatggcacagtagtccaggatccggagctaggccaggtca ttcagcttcagggtgatcagcgtaagaatgttgctactttcctagtccag gctgggattgcgaagaaggagctcatcaagatccacggcttctaagccga agccgcctccgataaatgctcgaaccgccagccggctcttctctatattg aaggcataaggcatatatatattgccgcccgcttgtcgaactgtgtcttg cttgatgcaagttgtgttgtcgcctgattattatgctgctgctgtaccgg catatcagtatggtttgtctaagatgttgccgactgaataaaaatccgta tcgtttggctaaaaaaaaaa
Download
page-top