Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683250
Length 719 bp
Fasta Format > whpc11k13
tctttctctctcgcaccgcaccgcaccgcaccgcgtcccctccctctcct gtcgcgtgcgctcggccagcaaaagcttccacataaaggccaacaagaga aaccttaatctgttgggtgccagtcaaacctcaacaacaaagtttcatgt ctgatctcgacgttactctgccatctgccttcgatccttttgctgaggca aatgctgaggatgctggtgcaggccccggcgcaaaagattatgtgcatgt gcgcatccagcagcgcaacggcaggaagagtctgaccactgtccagggcc tgaagaaggagttcagctacaacaagatcctcaaggatctcaagaaggaa ttctgctgcaatggcacagtagtccaggatccggagctaggccaggtcat tcagcttcagggtgatcagcgtaagaatgttgctactttcctagtccagg ctgggattgcgaagaaggagctcatcaagatccacggcttctaagccgaa gccgcctccgataaatgctcgaaccgccagccggctcttctctatattga aggcataaggcatatatatattgccgcccgcttgtcgaactgtgtcttgc ttgatgcaagttgtgttgtcgcctgattattatgctgctgctgtaccggc atatcagtatggtttgtctaagatgttgccgactgaataaaaatccgtat cgtttggccaaaaaaaaaa
Download
page-top