Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession BJ295641
Length 518 bp
Fasta Format > rwhsl4j16
tttttattnttnatattattatcttgcatgcatcgatcgagatgcagcag ctggctagtggcgacacggatatacatacgacatacgtacgtataagggg gcacacacacacacacacacattcaagtaggtacacagacgtatggctcc atgggctagctagctgacgtacggcgagggccagctagccgtagcattcc acatatgatcagcactgcctgatgcacttgcaccggcggaggggcccgtc gcagttgccgccgccccagcgttcctgcaggcagacctgcgcgcagttct tgtccgacacgcatggccccttgaaccccgcgctgcgctgccggcagatc ttcgcctccgcccccggcaccgccgcctcctgtgcgatgaggaggagaag caggaccaaaaccacctgcgtcgccaccttcttggtccacatggtgagcg gccgggctgggagcgagctaaactctgcttgcgctacgtactggctttgt tactaccggtggagttgc
Download
page-top