Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683097
Length 761 bp
Fasta Format > whpc10p22
agggtgttgggaaggcatttatcaccgctttccgctctggtgcagtcatg ggcttcttgttgtcatcaagtgggcttgtggttctttacatcaccatcaa tgtgttcaagatgtactacggtgatgactgggaaggtctttttgagtcca tcactggttatggtctgggtgggtcttccatggctctattcggaagagtt ggtggaggtatctacaccaaggctgctgacgtgggtgctgaccttgttgg caaagttgagaggaacattcctgaagatgacccaaggaacccagctgtaa ttgctgacaacgtcggtgacaatgttggtgatattgctgggatgggatca gatctctttggttcatacgcagaatcgtcctgcgctgctcttgttgttgc ttctatctcatcttttggaatcaaccatgatttcactgcgatgtgctacc cactgctcgtgagctctgttggcatcattgtttgcttgctcaccaccctg tttgcgactgatttctttgagatcaaggctgcaagcgaaattgaacctgc tctgaagaagcagctcatcatctccactgctttaatgactatcggtgttg cggtgatcagctggttggctctcccagctaagttcaccatcttcaacttc ggtgctcagaaggacgtgtccaactggggcctgttcttctgtgtggcagt tggtctgtgggctggtctgattattgggtttgtgaccnaatactacacta ncaatgcctac
Download
page-top