Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683036
Length 377 bp
Fasta Format > whpc10l20
tatcctgatgttaaccatgccactgtgaagactcccagtggagagaagcc tgntcgtgaacttgttcaagatgatgaatggctaaatggggagttcattg ccactgtccagcagcgtggtgctgcaatcatcaaagcgaggaagctctcc antgctctctctgctgccagctcagcttgtgatcacatccgtgactgggt tctgggaaccgctgagggaacatttgtttccatgggtgtgtactctgatg gttcatacggtgtgcctgctggtcttatctactccttcccagtaacgtgc agtggtggtgaatggacaattgttcaagggctcccgatcgatgagttctc gaggaagaagatggatgcgaccgccca
Download
page-top