Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ683028
Length 754 bp
Fasta Format > whpc10l08
gtttctgacgttaagaatgctattatctggggtaatcactcgtccagtca gtatcctgatgttaaccatgccactgtgaagactcccagtggagagaagc ctgttcgtgaacttgttcaagatgatgaatggctaaatggggagttcatt gccactgtccagcagcgtggtgctgcaatcatcaaagcgaggaagctctc cagtgctctctctgctgccagctcagcttgtgatcacatccgtgactggg ttctgggaaccgctgagggaacatttgtttccatgggtgtgtactctgat ggttcatacggtgtgcctgctggtcttatctactccttcccagtaacgtg cagtggtggtgaatggacaattgttcaagggctcccgatcgatgagttct cgaggaagaagatggatgcgaccgcccaggagctgtcagaggagaaggcg ttggcctactcatgcctggcgtaaatccacattcgaagggcagctgctcc tctggatgttttgaataaatgaaaccttccgctctttagaaactctcgtc tccacccagaacagccgcacatcgcgatgcatgctccttttcgctggttt tccaagtgtgtatgaatgaggcttgtagctccccttttgcctgatgattt acaggacagaacatttgctgcaagagtgaaacaatttgacacctgattag aatcaacttgtttttctcttgaagcatctaccaacaagtcacataaaaaa aaaa
Download
page-top