Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Fasta Format

Accession CJ682979
Length 274 bp
Fasta Format > whpc10h07
agagcaagccggagaccggcgaggtgatcggcgtcttcgagagcgtgcag ccgtcagacaccgacctcggcgccaaggcgcccaaggatgtcaagatcca gggtgtgtggtacgcgcagctcgagtctaactagagcagagcagaagtga agatgctcatcttgtgtgcatgcgtacgtgggttgatcgttggagaggaa acaatcgaggcaacaatgtgtgtttgtgtgtgtatctagtaatctaaacc cagggtgtcgttttaaaaaaaaaa
Download
page-top